FINDTAR3: Yaou Lab MicroRNA Target Prediction and Analysis

Help

Perform Online Calculation in Homepage

Two steps must be performed for processing miRNA target prediction query: select or enter query miRNA sequences, and query mRNA 3'UTR sequence. Generally, there are 3 ways of designating query miRNA: First, users can select a pre-defined miRNA database provide by our website (human, rat, mouse and drospholia data are provided). Once selected, our website is able to automatically correlate you selected database to the mRNA RefSeq database of your query species. therefore, by enter gene name or RefSeq number, users can approach their results easily. Second, users can input the inquery miRNA name in the "Enter inquiry miRNA name" blank, this blank can override the upper list which means the website calculates this input information prior to embedded database. You can then enter gene name or paste sequence in the query mRNA panel, and click "search" for obtaining the outcome. FindTar3 has been validated in species listed above. For those not listed in the menu, you may directly paste miRNA and/or mRNA 3'UTR sequences in FASTA format to the according blank. We also provide a temperature modification blank for those body temperature are not 37°C.

If you still have questions in using this online calculation page, you may visit our simpage from here which preloaded miRNA and mRNA sequences and may help you to acknowlege our website better.

Example of miRNA FASTA sequence:

    >hsa-miR-576-3p
    AAGAUGUGGAAAAAUUGGAAUC
    >hsa-miR-140-5p
    CAGUGGUUUUACCCUAUGGUAG
    >hsa-miR-124*
    CGUGUUCACAGCGGACCUUGAU
  

Examples of mRNA FASTA sequence:

    >hsa_GAPDH
    GACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACC
    CTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATC
    TCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGGCCTA
    GGGAGCCGCACCTTGTCATGTACCATCAATAAAGTACCCTGTGCTCAACC
  

You can directly enter the online calculation page here.

You can also visit our simpage to learn how to use this website in here.

 

Query MicroRNA Targets from FindTarBase

FindTarBase can provide global overview of miRNA targets in human, rat, mouse, zebrafish, fly and worms. If you intend to know what and how many genes a miRNA can target, or what and how many targets a gene 3'UTR have, FindTarBase can help you. First, select miRNA database in step 1, this drop-out will navigate to different database such as human or rats etc. Secondly, enter inquiry miRNA name (e.g. hsa-let-7a),and click "Search", all genes that putative regulated by your specific miRNA will be displayed. The outcome will be a very large dataset, therefore, we provide download function to .csv file, you can open the target list in Microsoft Excel etc. If you want to query all targets on specific gene 3'UTR, just select species in the Step 1 and enter gene name (e.g.GAPDH, gapdh) and Refseq number (e.g. NM_002046) in Step 2, all Refseq number corrspond to the query gene name will be displayed. Select a Refseq you need, and click "Continue", all targets will be showed in a table, including miRNA name, target position, putative secondary structure, central loop score, free energy and recommendation. In the upper contral panel, sorting and threshold cut-off control is available at your option. We also provide target file download at the bottom of the table. We highly recommend you to download target file to local computer and use our program miRBrowser to browse and analyze miRNA targets. You can download program and manual of miRBrowser from download page or click here.

You can directly enter FindTarBase here.

 

Local Running of FindTar3 Component

We provide FindTar3 online calculation as well as program downloading, you can install FindTar3 and miRBrowser in your local computer, which makes it easiler for large scale data processing. The specification for FindTar3 and miRBrowser is available in the download page, you can click here to access.

 

Still Have Any Question?

If you have any problem in using FindTar3, please contact lvtsing@gmail.com or zhangyo@sz.tsinghua.edu.cn.

 

For Advanced Windows User

For Windows user who intend to compile program themselves, please refer to our guide here.

About Us | Site Map | Copyright | ©2017 Division of Life Science, Graduate School at Shenzhen, Tsinghua University | School of Life Science, Tsinghua University